Maps and Traits



Marker development, genetic map construction and QTL mapping of important traits are keyto genetic improvement of peanut, which are progressing rapidly in recent year in peanut and can be found jounalsof the last decade. PGR lists only information used for this peanut genome project (some with trait QTLs), including (1) an high density map containing a density of 5022 SNP markers from cross of Yueyou92 and Xinhuixiaoli, (2) an SNP map of 1,765 markers from a cross between Zhonghua 5 and ICGV86699, and (3) an integrated map with 3693 markers of SSR and transcripson, which derived from more than 10 maps. (4) a high density map with 1,219 SSR or transcripson markers from Zhonghua 10 and ICG 12625. (5) a high density map with 1114 SSR or transcripson markers from two F2 mapping populations, SKF2 and NYF2, each derived from two peanut varieties.



Please input a keyword, a primer sequence, or go to Maps & Traits Browse.

Please input a keyword:

e.g. qF2TPS2, Pod weight 1-3, Ah2TC9F04

Or input a primer:

e.g. CCTAAACAACGACAAACACTCA