Marker information
| Marker Name | Seq4E08 | |
| Additional Name | CC000400;pPGPseq_4E08;pPGPSeq4E8 | |
| Marker type | Genome-SSR | |
| Motif / Pattern | (TC)16(TA)15 | |
| Forward primer (5'-3') | ||
| Reverse primer (5'-3') | GCTTGGTTTGGGTTAGTTTGA | |
| Resource | Ferguson et al., 2004 Mondal et al., 2014 Shirasawa et al., 2012b Shirasawa et al., 2013 |
|
| Linkage map | Species | Marker Name | Name used in map | Linkage group | Position (cM) | Reference |
| VG9514 x TAG24 | A. hypogaea | Seq4E08 | pPGPseq_4E08 | B08 | Peanut Base Mondal et al., 2014 | |
| Consensus map | A. hypogaea, A. duranensis, A. stenosperma, A. ipaensis, A. magna | Seq4E08 | Seq4E08 | B02 | Peanut Base Shirasawa et al., 2013 |
