Marker information
| Marker Name | TC23D04 | |
| Additional Name | Ah3TC23D04;JN887544 | |
| Marker type | SSR | |
| Motif / Pattern | (CT)7(TC)30(TG)7(CT)37 | |
| Forward primer (5'-3') | ||
| Reverse primer (5'-3') | GTAGCAAGCGTTAAGGACCTGT | |
| Resource | Macedo et al., 2012 Gautami et al., 2012b Shirasawa et al., 2013 |
|
| Linkage map | Species | Marker Name | Name used in map | Linkage group | Position (cM) | Reference |
| Consensus map | A. hypogaea, A. ipaensis, A. duranensis | TC23D04 | Ah3TC23D04 | A10 | Gautami et al., 2012b | |
| Consensus map | A. hypogaea, A. duranensis, A. stenosperma, A. ipaensis, A. magna | TC23D04 | TC23D04 | A10 | Peanut Base Shirasawa et al., 2013 |
